These are chat archives for cboursnell/transfuse

5th
May 2016
Graham Etherington
@ethering
May 05 2016 12:19

Hi, I’ve a quick question about Transfuse run time. I have a 7 Trinity transcriptome assemblies with between 100,000 and 275,000 transcripts each and paired end reads that when compressed are about 46Gb in size (each). I’m running Transfuse on this data, but it’s been over 3 weeks since the time stamp of the most recent files has been updated. The job is doing something, but when I ltrace the jobid I get the same output over and over again:
[pid 69411] memcpy(0x2ac61363e730, "AAGAAGCTAAGTGACTTGCACAAGGTCACACA"..., 101) = 0x2ac61363e730
[pid 69411] memcpy(0x2ac61363e8c0, "@CCFFFDDHHFBFGEHGJEHIJJJG@AFDGIG"..., 101) = 0x2ac61363e8c0
[pid 69411] strcmp("FASTQ", "FASTQ") = 0
[pid 69411] memcpy(0x2ac61363e730, "AAGAAGCTAAGTGACTTGCACAAGGTCACACA"..., 101) = 0x2ac61363e730
[pid 69411] memcpy(0x2ac61363e8c0, "@CCFFFDDHHFBFGEHGJEHIJJJG@AFDGIG"..., 101) = 0x2ac61363e8c0
[pid 69411] strcmp("FASTQ", "FASTQ")
etc, etc, etc,…..

Going from the fact that one of my transcript assemblies is called 'trinity_birkie_testis.Trinity_fixed.fasta' and my reads are called 'birkie_rna_1.fastq.gz' and 'birkie_rna_2.fastq.gz' do you think it’s OK that the most recent files in my output directory are:
2016-04-11 16:49:53.4495080880 ./transrate_trinity_birkie_testis.Trinity_fixed/birkie_rna_1.fastq.gz.birkie_rna_2.fastq.gz.trinity_birkie_testis.Trinity_fixed.bam
2016-04-11 15:49:22.2067730090 ./transrate_trinity_birkie_testis.Trinity_fixed/trinity_birkie_testis.Trinity_fixed/GenomeIndex
2016-04-11 15:49:22.0570423620 ./transrate_trinity_birkie_testis.Trinity_fixed/trinity_birkie_testis.Trinity_fixed/OverflowTable
2016-04-11 15:49:19.6636086670 ./transrate_trinity_birkie_testis.Trinity_fixed/trinity_birkie_testis.Trinity_fixed/GenomeIndexHash
2016-04-11 15:47:13.6697271610 ./transrate_trinity_birkie_testis.Trinity_fixed/trinity_birkie_testis.Trinity_fixed/Genome

and that they’ve not been updated for over 3 weeks?
Thanks for any help you can give me.
Cheers, Graham