These are chat archives for dereneaton/ipyrad

6th
Mar 2016
Deren Eaton
@dereneaton
Mar 06 2016 00:03 UTC
aha
I'm gonna run a quick svdquartet example in the workshop
it's working well enough
I'm probably going to add dendropy as a dependency to ipyrad.analysis eventually so we can do fancier things with trees. Either that or ete2, but I think dendropy is a bit more lightweight.
Isaac Overcast
@isaacovercast
Mar 06 2016 00:08 UTC
sweet, sounds good.
How was the stacks talk?
Deren Eaton
@dereneaton
Mar 06 2016 00:14 UTC
his workshop is waaaaay more formal than mine
Isaac Overcast
@isaacovercast
Mar 06 2016 00:15 UTC
Formal is boring.
Deren Eaton
@dereneaton
Mar 06 2016 00:15 UTC
I'm just gonna walk them through the docs, run through the tutorials with them, and then set them loose on a test data set.
and tease them a bunch with the new features that aren't ready yet, lol.
Isaac Overcast
@isaacovercast
Mar 06 2016 00:15 UTC
That's how you do it. Nobody learns by having some schmo jabber at you all day, you learn by doing.
Lol, nice.
Deren Eaton
@dereneaton
Mar 06 2016 00:16 UTC
yeah. I'm going to teach them some basic fun stuff too. Like how to use conda and jupyter notebooks
I think the server administrator here is annoyed that I want them all to install their own miniconda
he's adamant about loading a system wide ipyrad, even though I keep telling him that I don't want that, users should have their own sandboxed modules. It doesn't take that much space.
he's trying to install ipyrad and dependencies from source.
and I'm just like, good luck.
Isaac Overcast
@isaacovercast
Mar 06 2016 00:18 UTC
lol, glhf
Deren Eaton
@dereneaton
Mar 06 2016 00:18 UTC
he's seems pro, though. He might get it working.
I'll probably just have them run it locally on 4 cores instead of on the server for simplicity.
btw, is it easy to add 'dendropy' from the channel 'biopython' to our conda.recipe?
or should we host it to our own channel?
Isaac Overcast
@isaacovercast
Mar 06 2016 00:22 UTC
probably better to add from their channel so we don't have to deal with versioning, i'll look into it.
Deren Eaton
@dereneaton
Mar 06 2016 00:23 UTC
ok
I'm finally filling in the parameter explanations to the docs.
Deren Eaton
@dereneaton
Mar 06 2016 00:28 UTC
been putting it off cuz it's boring.
Isaac Overcast
@isaacovercast
Mar 06 2016 00:29 UTC
lol, yeah, boring but important.
refseq mapping for pair data has been fsck for a while, i'm fixing it
Deren Eaton
@dereneaton
Mar 06 2016 01:04 UTC
yeah, I'm not expecting that to be ready tomorrow. That sounds like a hard problem
I had to make this change to make refseq work on the latest pull (10 seconds ago):
            out.write("".join(seqs))
            out.write("//\n//\n")
flipped it around so //\n//\n comes after the seqs
otherwise I get an error
but maybe that is causing a problem...
Isaac Overcast
@isaacovercast
Mar 06 2016 01:06 UTC
What does it do if the //'s are before the seqs?
Deren Eaton
@dereneaton
Mar 06 2016 01:06 UTC
 --------------------------------------------------
  ipyrad [v.0.1.73]
  Interactive assembly and analysis of RADseq data
 --------------------------------------------------
  New Assembly: cli
  ipyparallel setup: Local connection to 4 Engines

  Step1: Demultiplexing fastq data to Samples
    Saving Assembly.
  Step2: Filtering reads 
    Saving Assembly.
  Step3: Clustering/Mapping reads
    Reference sequence index exists
[Engine Exception]
---------------------------------------------------------------------------IndexError                                Traceback (most recent call last)<string> in <module>()
/home/deren/Documents/ipyrad/ipyrad/assemble/cluster_within.pyc in muscle_align(args)
    149         if len(names) <= 1:
    150             if names:
--> 151                 stack = [names[0]+"\n"+seqs[0]]
    152         else:
    153             ## split seqs if paired end seqs
IndexError: list index out of range

None
    Saving Assembly.
  Step4: Joint estimation of error rate and heterozygosity
    Saving Assembly.
ipyrad error - 
    No Samples ready for joint estimation. First run step3().
//
//
>1A_0_2813_r1;size=19;*
TGCAGACTGTGACCGGATATGTTGGGGATTTAAAGAGATACGCGCCAAGACGGTGAGGAGGCGAACACCGTTGTACGTCTGGACATTGTTCGGG
>1A_0_2816_r1;size=1;+
TGCAGACTGTGACCGGATATGTTGGGGATTTAAAGAGATACGCGCCAAGTCGGTGAGGAGGCGAACACCGTTGTACGTCTGGACATTGTTCGGG
//
//
>1A_0_6303_r1;size=20;*
TGCAGAAAAAGCGCGGAGAACTATGGTCACACCTAATTCAAACCTCAGCCAAGCATGCGGTTCGGGATCAGTCAAATACTGTGTTCCTAGAATT
>1A_0_6320_r1;size=1;+
TGCAGAAAAAGCGCGGAGAACTATGGTCAGACCTAATTCAAACCTCAGCCAAGCATGCGGTTCGGGATCAGTCAAATACTGTGTTCCTAGAATT
//
//
>1A_0_2197_r1;size=18;*
TGCAGTCTGCGCCCGGGATGGATAACTTCCCTCAGTGCCGTAGACCAATAAAATGTTCACCGTCTGTGCGACAAATGATCGCCAGGCTCACAGC
>1A_0_4543_r1;size=12;+
TGCAGTCCTACCATGAATGGAGTTTCTTCCTAGTTCAACATCCCCGTAATGTAATTGTAGGTGTCGAGCTTCACATGCGACCAGTAAGGAACAT
>1A_0_4547_r1;size=1;+
TGCAGTCCTACCATGAATGGAGTTTCTTCCCAGTTCAACATCCCCGTAATGTAATTGTAGGTGTCGAGCTTCACATGCGACCAGTAAGGAACAT
//
//
that's the top of clust.gz when // comes first. The third cluster down is bad, too.
Isaac Overcast
@isaacovercast
Mar 06 2016 01:15 UTC
huh, i guess you're right, must have thought it fixed stuff earlier when i was messing with the messy sim genome, good catch.
i pushed the fix (had a couple other PE fixes in refmap as well).
Isaac Overcast
@isaacovercast
Mar 06 2016 01:21 UTC
Going off line for about an hour, i'll check back in in a bit...
Isaac Overcast
@isaacovercast
Mar 06 2016 03:11 UTC
i'm back if you need anything
Deren Eaton
@dereneaton
Mar 06 2016 03:43 UTC
Thanks, I'm out for dinner and drinks so probably won't have much more chance to make changes tonight. Thanks for crunching it today. If you want to add any more to the docs or the -i info that would help.
Deren Eaton
@dereneaton
Mar 06 2016 15:24 UTC
If you're able to push v.0.1.74 to anaconda for mac in the next hour that would be great. Otherwise I can try to do it here when I get to the mac lab.
Isaac Overcast
@isaacovercast
Mar 06 2016 16:38 UTC
done
good luck today! Let me know if there's anything i can do to help.
Deren Eaton
@dereneaton
Mar 06 2016 17:03 UTC
Awesome
It's working
Isaac Overcast
@isaacovercast
Mar 06 2016 17:19 UTC
:clap:
Deren Eaton
@dereneaton
Mar 06 2016 18:16 UTC
ugh, look at rtd. 10 failed build in a row. The site is down I htink
and it won't load the changes I made last night.
so we're having a tiny hiccup, but things are going pretty well.
Isaac Overcast
@isaacovercast
Mar 06 2016 18:23 UTC
I'll check it out
Deren Eaton
@dereneaton
Mar 06 2016 18:24 UTC
it's a server error, I don't think its our fault
Isaac Overcast
@isaacovercast
Mar 06 2016 18:36 UTC
rtfd/readthedocs.org#2002 <- yeh server side :thumbsdown:
Deren Eaton
@dereneaton
Mar 06 2016 19:57 UTC
The workshop rocked.
Isaac Overcast
@isaacovercast
Mar 06 2016 23:46 UTC
that great! psyched it went well. Did you get any good/useful feedback?