These are chat archives for dereneaton/ipyrad

30th
Oct 2017
asassone
@asassone
Oct 30 2017 10:33
@isaacovercast Thank you very much!
Isaac Overcast
@isaacovercast
Oct 30 2017 15:50
@sborstein Can you show me 5-10 lines of context around the error in the log file?
Katherine Silliman
@ksil91
Oct 30 2017 18:58

@dereneaton @isaacovercast I figured out the issue referenced in my previous post. I had 2 lanes of sequencing in the same folder, where the same library had been run on each lane. The file names were:

X-L001_R1_001.fastq.gz
X-L001_R1_002.fastq.gz
X-L002_R1_001.fastq.gz
X-L002_R1_002.fastq.gz

When I ran Step 1 separately on the 2 lanes, it worked and I was able to merge them later. It says in the documents here that you can just combine them into the same folder, but in my case it didn't work. Maybe a file name issue?

Sam Borstein
@sborstein
Oct 30 2017 23:32
Hi @isaacovercast . Here is the entries in the log file around the error.
2017-10-29 19:21:18,096     pid=20437     [cluster_within.py]    INFO     filtered by maxindels: 12 CAATTCTAATGATGTTGGTGGTCCTTTTTGCACCGTCGATAAATGAGTGTACCTTTTGGACAGGTCTGTTCTCAAATCCTCCCAGAACC
2017-10-29 19:21:22,151     pid=20395     [cluster_within.py]    INFO     build_clusters-[]-[]
2017-10-29 19:21:22,151     pid=20395     [cluster_within.py]    INFO     inside trackjobs of ref_build_and_muscle_chunk
2017-10-29 19:21:22,271     pid=20441     [refmap.py]    INFO     Entering bedtools_merge: Nruf_Flint2
2017-10-29 19:21:22,271     pid=20441     [refmap.py]    INFO     stdv: bedtools merge cmds: ['/home/sam/anaconda3/envs/py27/lib/python2.7/site-packages/bin/bedtools-linux-x86_64', 'bamtobed', '-i', '/home/sam/Desktop/Nothonotus_RAD/NothonotusRAD_refmapping/Nruf_Flint2-mapped-sorted.bam'] ['/home/sam/anaconda3/envs/py27/lib/python2.7/site-packages/bin/bedtools-linux-x86_64', 'merge', '-d', '-10', '-i', '-']
2017-10-29 19:21:23,567     pid=20441     [refmap.py]    INFO     bedtools_merge: Got # regions: 106403
2017-10-29 19:21:23,579     pid=20441     [refmap.py]    DEBUG     nregions 106403 chunksize 10643
2017-10-29 19:21:24,739     pid=20493     [cluster_within.py]    INFO     inside muscle_chunker
2017-10-29 19:21:26,744     pid=20493     [cluster_within.py]    INFO     optim for align chunks: 11501
2017-10-29 19:21:42,827     pid=20457     [cluster_within.py]    INFO     inside muscle_chunker
2017-10-29 19:21:44,536     pid=20457     [cluster_within.py]    INFO     optim for align chunks: 10331
2017-10-29 19:21:53,561     pid=20395     [assembly.py]    ERROR     ValueError(need more than 0 values to unpack)
2017-10-29 19:21:53,573     pid=20502     [cluster_within.py]    INFO     inside muscle_chunker
2017-10-29 19:21:54,831     pid=20395     [assembly.py]    INFO     interrupted engine 10 w/ SIGINT to 20502
2017-10-29 19:21:55,836     pid=20395     [assembly.py]    INFO       shutting down engines
2017-10-29 19:21:55,891     pid=20395     [assembly.py]    INFO       finished shutdown
2017-10-29 19:21:56,227     pid=20395     [__init__.py]    INFO     debugging turned off