These are chat archives for nellore/rail

8th
Jul 2015
maximus-b
@maximus-b
Jul 08 2015 02:52
Fire away
abhinav
@nellore
Jul 08 2015 02:56
okay, right after line 83, import tempdel, write
from collections import deque
mybuffer = deque()
now at line 348, instead of
try:
   print >>output_stream, '\t'.join(sam_line_to_print)
except IOError:
   raise IOError('Error writing line "%s".' % sam_line_to_print)
write
abhinav
@nellore
Jul 08 2015 03:02
if len(mybuffer) >= 10:
    mybuffer.popleft()
mybuffer.append('\t'.join(sam_line_to_print))
try:
    print >>output_stream, '\t'.join(sam_line_to_print)
except IOError:
    raise IOError('Error writing lines "%s".' % '\n'.join(mybuffer))
if len(mybuffer) >= 10:
    mybuffer.popleft()
mybuffer.append('\t'.join(sam_line_to_print))
try:
    print >>output_stream, '\t'.join(sam_line_to_print)
except IOError:
    raise IOError('Error writing lines "%s".' % '\n'.join(mybuffer))
this is just keeping the last 10 lines written in memory
hopefully the problem is somewhere in there
maximus-b
@maximus-b
Jul 08 2015 03:03
two times the same block?
abhinav
@nellore
Jul 08 2015 03:04
that include a new try-except block, which prints 10 lines from the buffer
no, replace the old try-except block with the 7 lines
maximus-b
@maximus-b
Jul 08 2015 03:05
OK. From my end it looks like you are asking me to put the same 7 lines twice.
abhinav
@nellore
Jul 08 2015 03:05
i'm sorry if i'm not being clear
i'll try agai
maximus-b
@maximus-b
Jul 08 2015 03:05
I think it's ok.
abhinav
@nellore
Jul 08 2015 03:06
n
do you see import tempdel at line 83?
maximus-b
@maximus-b
Jul 08 2015 03:08
Yes, and you said add
from collections import deque mybuffer = deque()
right after that, then at line 348, add in
if len(mybuffer) >= 10: mybuffer.popleft() mybuffer.append('\t'.join(sam_line_to_print)) try: print >>output_stream, '\t'.join(sam_line_to_print) except IOError: raise IOError('Error writing lines "%s".' % '\n'.join(mybuffer))
to replace the try--> raise IOError we edited previously.
abhinav
@nellore
Jul 08 2015 03:09
exactly
perfect
now resume and let's see what happens
maximus-b
@maximus-b
Jul 08 2015 03:09
I was asking because the if len(mybuffer) --> raise IOError block was printed twice on my end of the chat.
abhinav
@nellore
Jul 08 2015 03:09
we'll get the last ten lines, and one of them will hopefully be the offender
that's super-weird
maximus-b
@maximus-b
Jul 08 2015 03:10
So I resume with the same command as before right?
abhinav
@nellore
Jul 08 2015 03:10
yep
maximus-b
@maximus-b
Jul 08 2015 03:10
OK Thanks.
It's proven. You are getting weird stuff happening to your algo because of Max.
abhinav
@nellore
Jul 08 2015 03:11
nah, max is vital to rail
he's making it work better
maximus-b
@maximus-b
Jul 08 2015 03:13
This message was deleted
This message was deleted
This message was deleted
abhinav
@nellore
Jul 08 2015 03:18
3 deleted messages?
maximus-b
@maximus-b
Jul 08 2015 03:18
Ya
abhinav
@nellore
Jul 08 2015 03:18
did i miss something?
maximus-b
@maximus-b
Jul 08 2015 03:18
No, it's OK. I thought I did something clever, but then it wasn't. LOLx
So, no longer relevant.
abhinav
@nellore
Jul 08 2015 03:28
:-)
maximus-b
@maximus-b
Jul 08 2015 03:30
Ok. Now I think I did something "clever" again.
I used the sort command from the error log and piped it to grep 10 lines before and after that read which "choked" your bam.py. And. The one read after that read looked weird to me when I open that file in Excel (it is much much shorter that the other reads).
22266328    1    000000039606    000000002919    HWI-ST185:424:C07B7ACXX:7:1102:7908:143069_1:N:0:CAGATC    0    255    101M    *    0    0    GGAAGGGTCTCTCTGAGAATGTTCCAGCATTGGACAAGTACCTAGACAAACTGTAAATCACCAGACTCGATACAATCAATAATATAAGATCATCCTCTTTT    HHHHHHHHHHHHHhhhhhhhhhhhhhhhhhhhhhhhhhHHhhhhHhHhhhhhhhhhhHHhhhhhhhhhhhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    AS:i:194    XN:i:0    XM:i:1    XO:i:0    XG:i:0    NM:i:1    MD:Z:68T32YT:Z:UU    NH:i:1
22266329    1    000000012315    000000000527    HWI-ST185:424:C07B7ACXX:7:1102:7908:175342_2:N:0:CAGATC    0    255    101M    *    0    0    TCTCGAGAAGGAGGATTATACTATACACCGAAGACCAGTGACAACCACTCACATGCAATTCTGTTTAAGACACCCTTACAGGGTCCAATGACTTCAATTAA    HHHHHHHHHHHHHhhhhhhhhhhhhhhhhhhhhhhhhHHHhHhhhHhhhHHHhhhhhhhhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH5    AS:i:187    XN:i:0    XM:i:2    XO:i:0    XG:i:0    NM:i:2    MD:Z:7G8G84    YT:Z:UU    NH:i:1
22266330    1    000000019476    000000001346    HWI-ST185:424:C07B7ACXX:7:1102:7914:53010_1:N:0:CAGATC    0    255    101M    *    0    0    ATCTAACCGTTGATGGAAAAGCTGACATGGATGCATCTGTTACAAAGCCAGAAATTGATGTCAATGTGAAGTCACCTCAGCCATCTGCAGATGTAGATACA    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHhhhhHHH5HHHH#5HHHHH55H55HH5HHHHH5HHHH055H5HHHHHHHHH55#5H5HHHH555HHH    AS:i:195    XN:i:0    XM:i:1    XO:i:0    XG:i:0    NM:i:1    MD:Z:7T93YT:Z:UU    NH:i:1
22266331    1    000000012144    000000005469    HWI-ST185:424:C07B7ACXX:7:1102:7915:36692_1:Y:0:CAGATC    0    255    72M    *    0    0    CCTGCATCTCGTGTGATGTGGTGGCTGTGGGAGGGGTGGATGCTGGCACTTGGGAAGGGGGTATATCTGAAG    550HH5HHHHH0H00H550H500055HH000550HH055055555555HHH0#05555H55#0055#555HH    AS:i:129    XN:i:0    XM:i:3    XO:i:0    XG:i:0    NM:i:3    MD:Z:21A9C20A19    YT:Z:UU    NH:i:1
22266332    1    000000032063    000000002985    HWI-ST185:424:C07B7ACXX:7:1102:7918:165743_2:N:0:CAGATC    0    255    44S54M    *    0    0    CGTGTACTGAACTGCCAGGGATCTGGATCGACCTCAGACATTGTTGCTGGAGACGAATGGGTGGCCAATAATGGCATCAAACCCGCTGTTGCTTCCAT    HHHH5HHHH5HHHH0HHHHHHHHHhHHHH55HHHhHHHHHHHhhh5HH5HHHHH5HHHH555HHHHHHH00555HHHH5HHHH505055H#05H055H    AS:i:101    XN:i:0    XM:i:1    XO:i:0    XG:i:0    NM:i:1    MD:Z:3A50YT:Z:UU    NH:i:1
22266333    1    000000035510    000000000297    HWI-ST185:424:C07B7ACXX:7:1102:7920:83928_2:N:0:CAGATC    16    255    101M    *    0    0    TCATCTTGTAAAATTGGTGTTTCTACTTAGGGGAGCCCCACAAATCTAACCTAAGATCATCTTAGGTTCACAAAGCTTCACACTGCTGCTCATTATGTAGC    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHhhhhhhhHhhhhhhhhHHHHHhhhhhhhhhhhhhhhhhhhhhhhhhHHHhHhhhhhhHHHHHHHHHHHHH    AS:i:180    XN:i:0    XM:i:3    XO:i:0    XG:i:0    NM:i:3    MD:Z:25T41C10T22    YT:Z:UU    NH:i:1
22266334    1    000000385246    000000000046    HWI-ST185:424:C07B7ACXX:7:1102:7923:188992_1:N:0:CAGATC    0    255    76M25S    *    0    0    CTCTACCAAGTCACCACACATGACAGCCTGGAACAACATGCACAATATAGAAGGCTGAAAGGTTAGCTTTACCAGCATTGACTAATGTGCTGTACCACTGA    HHHHHHHHHHHHHhhhhhhhhhhhhhhhhhhhhhhhhhHhhHhhhhhhhhhhhhhhhhhhhhHHhhhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    AS:i:129    XN:i:0    XM:i:3    XO:i:0    XG:i:0    NM:i:3    MD:Z:4G51A4C14    YT:Z:UU    NH:i:1
22266335    1    000000057768    000000000160    HWI-ST185:424:C07B7ACXX:7:1102:7923:196518_1:N:0:CAGATC    0    255    86M520N15M    *    0    0    CAGTTATAGAACCAAGCTGCTGACTCTGGAGGTTGGCCATCCGTGTAGGTAGAAATAATAAACAGAAGGGTGCTTGTCTTCACAAAATCAGGCAGTATATG    HH55HHHHHHHHHHHHHHHHHhHHHHHH55HHHH#0HH5H5H50000HHHHHHHHH55HH55HH5HHHHH#5##5555HHH5HHHHHHHHHH5HH5H5HH5    AS:i:202    XS:i:172    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:101    YT:Z:UU    XS:A:-    NH:i:1
22266336    1    000000050239    000000000418    HWI-ST185:424:C07B7ACXX:7:1102:7925:135555_1:Y:0:CAGATC    16    255    81M    *    0    0    GGTAAAGAGGAAACAGAAGAGGAAAAGAACGATGATGAAGATGAAGACGATGATGACGATGAAGGTATTGAGGCAGAAGAG    HHH555555550055HH5555555505055#555005H5H555H00H05555#550055555H5H5H550500#H5##555    AS:i:158    XN:i:0    XM:i:1    XO:i:0    XG:i:0    NM:i:1    MD:Z:73A7    YT:Z:UU    NH:i:1
22266337    1    000000020842    000000004900    HWI-ST185:424:C07B7ACXX:7:1102:7931:143779_1:N:0:CAGATC    0    255    80M21S    *    0    0    GATATTGGCATTCCTGACATGTCCAACTGTTTCCTCAGAAACCTTTCAAGACCTCGCAAACCTCCGGTGAGACAAAAATCATAACCCCTTTCTTTTGCTCT    HHHHHHHHHHHHHHHHhhhhhHHhhhhHhHHHHHHhhhhhhhhHHHHhhHhHHHHhhhHHhhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    AS:i:160    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:80    YT:Z:UU    NH:i:1
22266338    1    000000425999    000000000000    HWI-ST185:424:C07B7ACXX:7:1102:7937:199452_1:N:0:CAGATC    4    0    *    *    0    0    ATTTGCAGCAAGTTGAGCCTCAGTAAAATAAAAGAAGAGTGGGGTTGAAATAAACCC    HHHHHHHHHHHHHhhHhhhHhhhHHhhhhhhhhhhhhhhHHHhhHhhhhhH#H5#5H    YT:Z:UU
22266339    1    000000009812    000000007686    HWI-ST185:424:C07B7ACXX:7:1102:7943:24616_2:N:0:CAGATC    16    255    100M1S    *    0    0    TTACTAAGCAACAGGAGAGAATATTTCTTGAAAAAGCAATAATGAGAAACTGTTTCTGCTTTGTCTTGTACCTGGAATTATTCGTAGAAGTTACACTGCCA    HHHHHHHHHHHHHHHHHHHHHHHHhhhhhhhhhhhHhhhhhhHhhhhHHhhhhhhHHhhhhhhhhhhhHHhhhhhhhhhhhhhhhhhhHHHHHHHHHHHHH    AS:i:200    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:100    YT:Z:UU    NH:i:1
22266340    1    000000060606    000000000545    HWI-ST185:424:C07B7ACXX:7:1102:7945:111501_2:N:0:CAGATC    0    255    72M214N29M    *    0    0    TTCTTTCTCAGGTTCTGGACACCTGTCAGCTCACGGCCAAAGTCGTCGGACATGGTCAGCAGCTTTTTCTCTTTGATCCATGTTTCTTCATCCTCTATGTC    HHHHHHHHHHHHHhhhhhhhhhhhhhhhhhhhhhhhhhhhhhHHHHhhh5HHhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    AS:i:202    XS:i:187    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:101    YT:Z:UU    XS:A:-    NH:i:1
22266341    1    000000001154    000000011554    HWI-ST185:424:C07B7ACXX:7:1102:7950:105963_2:N:0:CAGATC    16    255    4M361N97M    *    0    0    TGGGGTAATGAGGAATTCTGGACCAACCACACTCTGAATGAGAACTTTAAGATCGGTACCGTAAATGTGACCACAGAGGAGGAAAAATCAATCGATTCTAC    HHHHHHHHHHHH5HHHHHHHHHHH5HHHHH5HHhhHHHHHHH5HhhHHHHHHHhhHHHhHHHHhhhhHHHHHHhHhhhHHHHhhhhHHHHHHHHHHHHHHH    AS:i:202    XS:i:198    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:101    YT:Z:UU    XS:A:+    NH:i:1
22266342    1    000000137879    000000000706    HWI-ST185:424:C07B7ACXX:7:1102:7954:96580_2:N:0:CAGATC    0    255    42S59M    *    0    0    CGGAGCACTCCATCCTCAAAACGATCTTCTTTGTGGTCTTAGCCTTCTTCCTGAAGATTGGTTTTGTTTGTCCTCCGTAACCTTCCTGTTTTCTGTCATAA    HHHHHHHHHHHHHhHhHhhhhHHHHHHHHhhhHHHHHHHHHHhHhhHhhhHHhhHhHHHhhHHhHHhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    AS:i:118    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:59    YT:Z:UU    NH:i:1
22266343    1    000000016819    000000001976    HWI-ST185:424:C07B7ACXX:7:1102:7970:162063_1:N:0:CAGATC    16    255    61M570N40M    *    0    0    TGGGGATTGGACAGAATCGATCAGCGCAGTCTCCCTCTTAACAATGGTTACAGTCCTAAGGGAACTGGCAGCGGAGTTTCCGTCTATGTTCTTGATACCGG    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHhhhhhhhhhhhhHhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhHHHHHHHHHHHHH    AS:i:202    XS:i:124    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:101    YT:Z:UU    XS:A:+    NH:i:1
22266344    1    000000309160    000000000118    HWI-ST185:424:C07B7ACXX:7:1102:7971:79456_2:N:0:CAGATC    0    255    101M    *    0    0    GAAGTTTTCAACAGATATAAGATACCACTCGTTAGAAAGCTAACACATTGGCCATTCATGGCTTTTTCAATTTTCCGTACCTTAGCTGGTTAGATTTTCTG    HHHHHHHHHHHHHHH55HhHH5H5H0H5HHHHH5HHhHHHHHhHHHHHHHH#HHHHHHHHH05HHHHHHHHhhhhhHH5H5HH5HHHHHHHHH55HHHHHH    AS:i:195    XN:i:0    XM:i:1    XO:i:0    XG:i:0    NM:i:1    MD:Z:41G59YT:Z:UU    NH:i:1
22266345    1    000000021833    000000001442    HWI-ST185:424:C07B7ACXX:7:1102:7979:170635_1:N:0:CAGATC    0    255    3S9M1533N87M    *    0    0    TCTTAAACAATGTCCCATCTCACTGTGGACCATCAAAGGAAGAAGAAGTGGCTGAGTTTGCGTGGCTGGATCCCGTCTCAGACTTGAAGTGTGAAGGAT    HHHHHHHHHHHHH5HHHHHHhHHHHHHH0H55HHHHHHHHHHHH5HHH##50HHH5H#5HH#05H55#55HHHHHHHHHHHHH55555005#5555HHH    AS:i:192    XS:i:176    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:96    YT:Z:UU    XS:A:+    NH:i:1
22266346    1    000000006741    000000010475    HWI-ST185:424:C07B7ACXX:7:1102:7983:72629_1:N:0:CAGATC    16    255    101M    *    0    0    CAGTGACTAGGTCGTCATGGCTGTTTGGGAAAAGATACCTTTACCTAACTGTTTATCTTGGTGGGGTCACCACCTATGAATTATTGGATATGTGTGAAGAG    HHHHHHHHHHHHHHHHHHHHHHHHHHHhhhhhhhHHHhhhHHHhhhhhhhhhhhhhhhhhhhhhhhhHHHHHhhhhhhhhhhhhhhhhHHHHHHHHHHHHH    AS:i:195    XN:i:0    XM:i:1    XO:i:0    XG:i:0    NM:i:1    MD:Z:13A87YT:Z:UU    NH:i:1
22266347    1    000000075648    000000001539    HWI-ST185:424:C07B7ACXX:7:1102:7984:168513_2:N:0:CAGATC    16    255    101M    *    0    0    CGACGTATCGAACTACTTTAACGCTTAAAGGTGGATGGCCGACGGCCGATCCACTGAATAATTCTGGTTTCCATTTCTGCAATATATTATTGCCCCTTTTG    HHHHHHHHH5H5HH5HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHhhhhhhhhhhHHhhhhhhhHhhhhhhhhHhhhhhhhhHHHHHHHHHHHHH    AS:i:181    XN:i:0    XM:i:3    XO:i:0    XG:i:0    NM:i:3    MD:Z:10G7C10T71    YT:Z:UU    NH:i:1
22266348    1    000000000998    000000015471    HWI-ST185:424:C07B7ACXX:7:1102:7985:22624_2:N:0:CAGATC    16    255    45M1589N56M    *    0    0    AGATGCCTAGCGACTGGTTGAACAAGTACTGCATCTCTGACCTAGCTCTCACCGTAAAGATTAAGCCAAGGCAGAGAGTCAGACTGTACTCTAATTACATC    HHHHHHHHHHHHHHHHHHHHHHHHHhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhHHHHHHHHHHHHHHH    AS:i:202    XS:i:116    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:101    YT:Z:UU    XS:A:+    NH:i:1
Ignore the first column, I made it print line numbers.
abhinav
@nellore
Jul 08 2015 03:35
there's no space between XS:A:- and NH:i:1 in some of the lines; is that just an issue with your paste?
and thanks for your cleverness!
which read looks short to you?
maximus-b
@maximus-b
Jul 08 2015 03:36
line 22266338
The no space issue is probably my paste. I am pasting directly from the terminal.
abhinav
@nellore
Jul 08 2015 03:39
is this the same output as in the 1.0.log file?
maximus-b
@maximus-b
Jul 08 2015 03:44
Yes, from the last 1.0.log file It reported that read, so I used the sort command in the log file and grepped for ten lines before and after that read.
The last "clever" attempt was to grep ten lines before the line number that was reported in the log file. But I didn't see that error-causing read in that dump, so I deleted the messages I left you.
Speaking of that, is it possible that sorting of the sam files like that produces different results each time, and therefore raises errors non-systematically?
abhinav
@nellore
Jul 08 2015 03:48
it would be possible if you were using a different version of coreutils sort
i did find a bug in a recent version of coreutils sort, but i wrote a workaround
maximus-b
@maximus-b
Jul 08 2015 03:49
sort (GNU coreutils) 8.13
abhinav
@nellore
Jul 08 2015 03:49
yeah that's fine
the columns were in that order?
i'm confused why read positions are before read names
hang on
maximus-b
@maximus-b
Jul 08 2015 03:51
And... I also don't really understand SAM format and its requirements, but is column 3 for line 22266338 OK being 000000000000?
abhinav
@nellore
Jul 08 2015 03:51
no
maximus-b
@maximus-b
Jul 08 2015 03:51
I should not have messed with the columns, they are much harder to swap than lines.
abhinav
@nellore
Jul 08 2015 03:51
that's it
SAM is 1-based
but that read is unmapped
so i'm confused why it has a position
it didn't, did it?
maximus-b
@maximus-b
Jul 08 2015 03:53
which column is a position again?
(Bad with SAM)
Column 3 is supposed to be RNAME
abhinav
@nellore
Jul 08 2015 03:54
well in SAM format, the first column is the read name, the second column is the flag, the third is the chromosome, the fourth is the position, the fifth is mapq, the sixth is cigar...
so i'm confused what happened
maximus-b
@maximus-b
Jul 08 2015 03:54
OK in the one I paste, you just have to kinda move one column bcz the first column is line number after sort.
abhinav
@nellore
Jul 08 2015 03:54
did you paste the content of the log file or the content of the excel spreadsheet?
because excel could be zeroing some columns
maximus-b
@maximus-b
Jul 08 2015 03:55
content of the excel spreadsheet.
abhinav
@nellore
Jul 08 2015 03:55
can we do the raw 1.0.log?
maximus-b
@maximus-b
Jul 08 2015 03:55
abhinav
@nellore
Jul 08 2015 03:55
yep
that'd be great!
maximus-b
@maximus-b
Jul 08 2015 03:56
That is kinda not possible now
abhinav
@nellore
Jul 08 2015 03:56
doh
maximus-b
@maximus-b
Jul 08 2015 03:56
Because bam.py is running
abhinav
@nellore
Jul 08 2015 03:56
what happened?
maximus-b
@maximus-b
Jul 08 2015 03:56
and 1.0.log is being replaced?
abhinav
@nellore
Jul 08 2015 03:56
yeah
so when it's done, we can try again?
maximus-b
@maximus-b
Jul 08 2015 03:56
OK.
Oh... I see... not so clever after all. Because the bams are being replaced too and therefore do not sort similarly to the last time we run. OK. Sorry.
My bad.
completely.
abhinav
@nellore
Jul 08 2015 03:58
oh don't worry about it
we're all amateurs in some sense when we're analyzing new data, using new software, or encountering new bugs
maximus-b
@maximus-b
Jul 08 2015 04:02
thumbs up
maximus-b
@maximus-b
Jul 08 2015 05:42
[E::sam_parse1] unrecognized type
[W::sam_read1] parse error at line 52072526
[main_samview] truncated file.
Traceback (most recent call last):
  File "app_main.py", line 75, in run_toplevel
  File "/home/user/raildotbio/rail-rna/rna/steps/bam.py", line 354, in <module>
    raise IOError('Error writing lines "%s".' % '\n'.join(mybuffer))
IOError: Error writing lines "HWI-ST185:424:C07B7ACXX:7:1102:7934:41689_2:N:0:CAGATC    4    *    0    0    *    *    0    0    GGAAACTCGGTACAATACCAATTACAAAGATGTTATCTCTGAGGTGATGAAAGAATGGAATTGATTTGACTGGTAGATTAGTGTGTTATTCACATTAACTC    HHHHHHHHHHHHHhhhhhHHHHhHhhhHHhHHHHHHhhhhHHHHHHHHHHHHHHhhHHhhhHHHHHHhhhhhhHHH5HHHHHHHH5HHHHHHHHHHHHHHH    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7935:50245_1:N:0:CAGATC    4    *    0    0    *    *    0    0    CTTAAGACTTCACAAGTTTGTACTACATTTCTGTTTCGGTGTTCCTTAATGCACCAGCTGTGGTCAACTATAGCTGCCATTTGGAGACTGCACAAACGTTG    HHHHHHHHHHHHHHHHHHHHHHhHhhHHHhHHHhHhHHH5HHHHHhhHHHH5HHHHHHhhh5H5HHHHHHHHHHhhHHHHHHHHHHHHHHHHHHHHHHHHH    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7936:13918_2:N:0:CAGATC    4    *    0    0    *    *    0    0    AAAAATACAAATTACACATACTTTTATTGGAAACACGAAACTGAAATTTATGTCTTTGTTTACTTTGTAGTTAAAAAACTGTGAGTTGTTTACATTTCTTT    5HHHHHHHHHHHHHHHHHHHHHHHHHHHHHhHHHHHHHhhhHHHHHhHHHHHHHHhhHhHHHHhhHHhhhHHhHHHHHHHHHHH5HHHHHHHH5HHHHHHH    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7937:143022_1:N:0:CAGATC    4    *    0    0    *    *    0    0    CTTGGTGGAAGCCAAAATGCCGTCTCACAAGTCATTTAAGATCAAGCAGAAGCTGGCACGAAAGCAGAAGCAGAATCGGCCAATCCCACAGTGGATCAGAC    HHHHHHHHHHHHHhhhhhhhhhHhhhhhhhhHhhhhhhhhhhhhhhhhhhHHhHhhhhhhhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7937:143022_2:N:0:CAGATC    4    *    0    0    *    *    0    0    CCTGAGTCTGATCCACTGTGGGATTGGCCGATTCTGCTTCTGCTTTCGTGCCAGCTTCTGCTTGATCTTAAATGACTTGTGAGACGGCATTTTGGCTTCCA    HHHHHHHHHHHHHhhhhhHhhhhhhhhhhhhhhhhhhhhhhhhhhhhhHHHHhhhHhhhhhhhhHhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7937:199452_1:N:0:CAGATC    4    *    0    0    *    *    0    0    ATTTGCAGCAAGTTGAGCCTCAGTAAAATAAAAGAAGAGTGGGGTTGAAATAAACCC    HHHHHHHHHHHHHhhHhhhHhhhHHhhhhhhhhhhhhhhHHHhhHhhhhhH#H5#5H    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7938:199562_1:N:0:CAGATC    4    *    0    0    *    *    0    0    GCCAAGGCTGCATAGGACTCTCAAGTAGACTCTTAACATTGTAGCAACAATGAGCGGAGCATCTGGTAGATTTAATCCAGCTTTTGAAAGCCAATATCAGG    HHHHHHHHHHHHHhhhHHhhhhhHHHHHHHHHhHHhhhhhHHhHHhHHHHHH5HHHHHHHhHHHHH5HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7942:165605_1:N:0:CAGATC    4    *    0    0    *    *    0    0    GATGACTTTATTCGTAATTCAATAAAACAGTTCACTGTTATCCCATCACCGAAGTTTAACTCGACACTCATATGAGTTTACATTACGCTCCCATTAACCAA    HHHHHHHHHHHHHhHhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhHHhhhhhhhhhhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7944:77426_1:N:0:CAGATC    4    *    0    0    *    *    0    0    CACTAGGGTACATAATGTTAAAAGTAGGAGAGCGAGATACGCTGGTTTCACTGTGGGAGAAAAATTTACCGTTCAGGTAGCTGCAATTAACTCTCGAGGAA    HHHHHHHHHHHHHhhhhhhhhhhhHHHhhhhhhhhhhhhhhhhhhHHHhhhhhHhhhhhhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH55    YT:Z:UU
HWI-ST185:424:C07B7ACXX:7:1102:7944:77426_2:N:0:CAGATC    4    *    0    0    *    *    0    0    AAGATATAAAGGAATCGGGTGCATATCATGTCAAACTATTCTCAAATCATGTGCCAAACCTTCCAGAGACCACTGGAGAATATGGCCCTATTCCTCGAGAG    HHHHHHHHHHHHHhhhhhhHHhhhhhhhhhHhHhhhhhhhhhhhhhhhHhhhhhhhhhhhhhhhhHhhhhhhHHHHHHHHHHHHHHHHHHHHHHHHHHHHH    YT:Z:UU".
They look similar
abhinav
@nellore
Jul 08 2015 17:42
@maximus-b okay, you know how it says command X failed when you run it, and it gives you the precise command with bam.py in it? there's a sort command that's piped into it. all i want you to do is dump that sort into a file, and then we can study lines around 52072526