Maybe make a release candidate and see what people say after a week or two..
This branch is 252 commits ahead, 66 commits behind simongog:master.
Is this fork supposed to be the new primary repo?
Would be nice to have USCiLab/cereal#712 such that we can pin the release in sdsl and seqan3; in general, the only thing I'd like to do for sdsl before release is to pin all dependencies to some release, as far as possible
report from @timosachsenberg: the OpenMS argument parsing refactoring is done
What are the next steps on the Seqan side?
What are the next steps on the Seqan side?
2 replies
I think we can do a merge of release into master (we do this regularly)
8 replies
how can I request a re-run of the CI?
You can probably just rebase onto current master
is this range-v3 bug fixed upstream? https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=997289 If so, can we get a new release?
However, due to a bug in range-v3 + gcc 10.3.0, it is scheduled to be removed on December 6th âšī¸
https://bugs.debian.org/997289
https://bugs.debian.org/997289
1 reply
Both, from the Debian testing distribution, until the range-v3 bug is fixed
I am happy to carry a patch to fix this; it won't require a new upstream release for us to fix it
2 replies
Yes, it was reported upstream ericniebler/range-v3#1672
Hellooooo. I have a question about how to implement something. I have a function which takes a sam_file_input and filters for reads matching a certain criteria. I want to output those reads, either as a vector of records or as a separate sam_file_input. Here's the signature of my function:
template <typename traits_type, typename fields_type, typename format_type>
inline void filter_file(seqan3::sam_file_input<traits_type, fields_type, format_type> & input)I did the templates this way so that the function takes any sam_file_input regardless of how it was created (e.g. sam_file input my_input{file_path} vs requesting certain fields).
How can I make it so that I store the records of choice (either in a vector on into a second sam_file_input)? I wasn't sure how to figure out the type of the records, and I wasn't sure how to create a sam_file_input and then push back records into that.
and make the return type
auto
replace
FILTER with a lambda function that does your filtering
Ah thanks! But in that case, I would read through the entire input file, even if I only wanted a few reads right? To elaborate on my use case, I am using the file_position to extract reads in specific regions of a BAM file. So the function actually looks more like this:
template <typename traits_type, typename fields_type, typename format_type>
inline void filter_file(seqan3::sam_file_input<traits_type, fields_type, format_type> & input, std::streampos const & file_position)
And then I use
seek_to to jump to the position. Then I want to output records for the next 100 base pairs, for example.
You mean that you seek on the istream before passing that to sam_file? You can use
std::views::take_while(CONDITION) instead of or in addition to std::views::filter(). Make the condition that the position is inside your region. Then it will stop processing input as soon as you leave that region.
But in general this should be provided by the file of course.
Hi, does anybody now a small library (preferrably header only) that writes/parses e.g. YAML, XML or JSON (or else)?
I would like to write out something like a config file from my command line arguments in my application. And if it turns out to work well we might be able to include it in the seqan3 argument parser.
I would like to write out something like a config file from my command line arguments in my application. And if it turns out to work well we might be able to include it in the seqan3 argument parser.
13 replies
template <typename traits_type, typename fields_type, typename format_type>
inline auto get_overlap_records(seqan3::sam_file_input<traits_type, fields_type, format_type> & input,...)
{
...
auto results_list = input | std::views::take_while([file_position](auto & rec) {return file_position != -1;})
| std::views::take_while([end](auto & rec) {return std::make_tuple(rec.reference_id().value(), rec.reference_position().value()) < end;})
| std::views::filter([](auto & rec) {return !unmapped(rec);})
| seqan3::views::to<std::vector>;
...
return results_list;
}
The issue is: I can write
results_list to an output file just fine (sam_file_output out{out_file}; results_list | out;), but if I try and access individual elements within results_list, I get errors. Specifically, I tried doing debug_stream << results_list, and I tried using EXPECT_EQ(results_list1, results_list2) for two separate calls to the function.
Here's an example of the error I get:
[(CTTTGGGAGGCCAGGAGTTCAACATCAGCCTGGGCAACATGGTGAAACCACGTCTCTACCAAAAATACAAAAATTAGATGGGCATGGTGGCATGTGCCTGT,simulated_mult_chr_small-chr2-65,0,1,6,(unknown file: Failure
C++ exception with description "Access is not allowed because there is no sequence information." thrown in the test body.
"
Looking at the error and matching what was printed with the default fields, it seems it's
seqan3::field::alignment which maybe is not present in my SAM file but the debug_stream/comparison functions try and access.
18 replies